Identification of Gene Sequences Suitable for Mutation Analysis in Marine Species: the Application of Expressed Sequence Tags of European Flounder (Platichthys flesus) Liver RNA

Zheng Ye1, Brett Lyons2, Gareth J.S. Jenkins1, James Harvey3, James M. Parry1*

1Centre for Molecular Genetics and Toxicology

University of Wales Swansea, Singleton Park, Swansea SA2 8PP, UK

2Centre for Environment, Fisheries and Aquaculture Science

Lowestoft Lab., Parkefield Road, Suffolk, NR33 OHT, UK

3Smithkline Beecham Laboratories, The Frythe, Welwyn

Hertfordshire AL6 9AR, UK

*corresponding author

e-mail: JMP@swansea.ac.uk

Tel. No. (44) 1792 205678

Fax. No. (44) 1792 295447

 

Abstract:

We report here the identification of a number of expressed genes in the liver of the fish the European flounder. The aim of the study was to generate DNA sequence data which are currently not available in the species and which may be used to analyse mutational changes in flounder induced by environmental chemicals. A cDNA library of European flounder liver was constructed in l TriplEx2. The number of clones in this library is about 6 107. Two hundred and twelve clones were randomly selected and of these, 50 clones were sequenced. These sequences were compared with those in the EMBL and EST databases. Thirty one clones were found to encode 14 different genes, 4 unidentified sequences and 11 different ESTs respectively. Five of 14 genes had not been previously reported in fish. Furthermore, there is a very high homology between the European flounder and Japanese flounder in the genes identified.

Keywords: expressed sequence tags, Platichthys flesus, DNA sequence, cDNA library,

clone, database

Abbreviations: EMBL, European Molecular Biology Laboratory sequence database; dbEST, EST database; NMDA, N-methyl-D-aspartate receptor

 

Introduction:

The discovery of novel genes suitable for mutation analyses has traditionally been a laborious task requiring months or even years of work at the bench. However, in the current era of large scale genome sequencing, identifying suitable genes for mutational analyses can be reduced to the few minutes it takes to perform a computer-driven search of sequence databases (Tilghman, 1996). The database with the highest rate of growth has been a division of Genbank called dbEST (Boguski et al, 1993). This database is based upon expressed sequence tags, or short sequences, which are a few hundred base pairs in length, which are derived by partial, single pass sequencing of the inserts of randomly selected cDNA clones (Adams et al, 1991). It is a powerful strategy for identifying new genes and determining the pattern of gene expression in a particular tissue or cell. Information from expressed sequence tags has also been used in many other applications, including mapping of genomes, and the identification of coding regions in genomic sequences. This approach to cDNA characterization facilitates the tagging of genes at a fraction of the cost of complete genomic sequencing providing new genetic markers, and serving as a resource in diverse biological research fields.

ESTs are also a rapid and efficient way of establishing a detailed profile of the genes expressed in a tissue or cell type. A typical mammalian cell contains between 10,000 and 30,000 unique mRNA sequences. A large number of human cDNA clones expressed in various organs, tissues, and cells have been sequenced. Nearly 75% of the reported ESTs were derived from human cDNAs. However, only 0.03% ESTs in dbEST are from fish. Some of these genes had not previously been described in fish (Sadao et al, 1997; Ikuo and Takashi, 1997).

Fish are useful models for mutational analysis, and the identification of mutagenic chemicals in the aquatic environment (Powers, 1989; Sueiro et al, 2000). The European flounder (Platichthys flesus) is a common flatfish species of European estuarine and coastal waters and is becoming increasing used as a sentinel species in both field and laboratory based monitoring studies (Sueiro et al, 2000). However, there is a paucity of gene sequence information for flounder when compared with many other animals used for mutation analyses purposes such as mouse, Xenopus and Drosophia.

In this study, we have constructed cDNA library from RNA isolated from European flounder liver, and determined the DNA sequences of a number of the clones.

Materials and Methods:

Construction of the cDNA library

Samples at the European flounder, Platichthys flesus, were obtained from the Centre for Envieonment, Fisheries and Aquaculture Science (CEFAS), Lowestoft. RNA was isolated from liver using RNasy Midi kit (QIAGEN, Germany). cDNA synthesis was performed using a cDNA synthesis kit (Clontech, USA) with an oligo (dT) primer. The cDNA library was constructed in the l expression vector l TriplEx2, according to the manufactorer’s instruction (Clontech, USA).

Determining of DNA sequencing

Conversion of the recombinant l TriplEx2 into pTriplEx2 plasmids was carried out by in vivo excision and circularization according to the manufactuer’s protocol (Clontech, USA). Recombinant plasmid DNA was isolated by QIAprep Spin Miniprep kit (QIAGEN, Germany). Inserted fragments were amplified by Advantage2 PCR Kit (Clontech, USA). 5’-primer: 5’-ctc ggg aag cgc gcc att gtg ttg gt-3’; 3’-primer: 5’-ata cga ctc act ata ggg cga att ggc c-3’. Then cDNA fragments were sequenced by MWG Biotech (Germany).

Data analysis

Sequence data were compared with EMBL including dbEST for identification using the Fasta program (http://www.menu.hgmp.mrc.ac.uk, access to fasta program). They were submitted to Genbank to obtain accession numbers.

Results and Discussion:

A cDNA libraries of 6 107 clones was constructed from the polyadenylated fraction of European flounder liver RNA. The number of clones in the constructed cDNA libraries were considered adequate to cover the predominately expressed mRNA in the liver. We randomly chose 212 clones, amplified these by PCR. From these, 50 clones (24%) with inserted cDNA were selected and sequenced (for sequence data see Appendix 1). Thirty one of the sequenced clones were found to be compatible with genes in the EMBL database: they encoded 14 different genes, 4 unidentified sequences and 11 different ESTs respectively (Table 1). Among them, two clones were homologous to transcripts of uridine phosphorylase, and another two encoded the fibrinogen alpha subunit. Five of 14 genes had not been previously reported in fish: i.e. BE638437, ribosomal protein; BE638431, inter-alpha-trypsin inhibitor; BE638439, N-methyl-D-aspartate receptor modulatory subunit; BE638446, cosmids QC5E3; BE638412, Cytosolic glycoprotein FP21. Thirty one of the 50 clones (62%) could be putatively identified: 23 corresponding to fully characterized mRNAs, 4 were homologous to ribosomal protein, 4 were unknown transcripts of the genome. In addition, a summary of the identified genes shows that there is a very high homology between European flounder and Japanese flounder in the identified genes: BE638449, to ribosomal protein s26 (94%); BE638459, to ribosomal protein s11 (96%); BE638460, to translational regulatory factor (95%). During our database similarity searching, we found several different clones encoding different sections of the same genes: BE638420 and BE638451, Uridine phosphorylase; BE638429 and BE638455, Fibrinogen alpha subunit; BE638428 and BE638439, cloneLA10(4); BE638411 and BE638444, Embryo mouse EST39170; BE638440 and BE638454, cloneLA6(9); BE638414 and BE638432, human EST2357681. This suggests that our cDNA library was successfully constructed, and the results can be reproduced.

Sequences of 35 of these 50 clones (70%) had not previously been reported in fish. These results suggest that EST analysis is a useful and powerful method for isolating previously unreported genes from fish. These cloned ESTs can be used for mutational studies, chromosome mapping, DNA probes for gene cloning, molecular DNA markers, and for analysis of gene expressed in specific tissue or cells.

Current work in our laboratory includes extending the sequencing of flounder cDNA clones, in an attempt to identify more genes expressed in the liver. We hope to use these newly identified genes as targets for mutation detection in environmental biomonitoring studies. We routinely employ a genotypic mutation test in our laboratory, named the Restrition Site Mutation (RSM) assay. This assay detects mutation in DNA sequences, specifically at restriction sites (Sueiro et al, 2000). This assay has been employed in our laboratory to study mutation induction in flounder livers. Through the provision of new sequence data, more mutational targets are now available in flounder. An example of the range of restriction sites suitable for use in RSM analysis is shown in Table 2 for BE638418, which is homologous with human EST2112059. In addition, we ultimately hope to employ this library of flounder liver genes in differential display experiments examining regulation of genes in fish to environmental pollution.

 

Table 1. Similarity searches for European flounder liver cDNA:

Accession number

Genes

Closes species (accession number)

Homology (%)

Sequence length(bp)

BE638420

BE638451

BE638425

BE638449

BE638459

BE638429

BE638455

BE638460

BE638428

BE638440

BE638454

BE638456

BE638438

BE638443

BE638452

BE638437

BE638411

BE638444

BE638447

BE638419

BE638431

BE638439

BE638446

BE638414

BE638418

BE638422

BE638430

BE638432

BE638450

BE638445

BE638412

BE638413

BE638415

BE638416

BE638417

BE638421

BE638423

BE638424

BE638426

BE638427

BE638433

BE638434

BE638435

BE638436

BE638441

BE638442

BE638448

BE638453

BE638457

BE638458

Uridine phosphorylase

Uridine phosphorylase

Ribosomal protein L23

Ribosomal protein S26

Ribosomal protein S11

Fibrinogen alpha subunit

Fibrinogen alpha subunit

Translational regulatory factor

Clone LA10(4)

Clone LA6(9)

Clone LA6(9)

Clone LE2(8)

Trypsin III

Regulatory plasma protein

Unknown gene

Ribosomal protein

Embryo mouseEST391700

Embryo mouseEST391700

MouseEST1380050

Embryo ratEST203632

Inter-alpha-trypsin inhibitor

NMDA receptor subunit

Cosmids QC5E3

Human EST2357681

Human EST2112059

Human EST182168

Human EST1700882

Human EST2357681

Human EST2263551

EST1014

Cytosolic glycoprotein FP21

Unidentified

Unidentified

Unidentified

Unidentified

Unidentified

Unidentified

Unidentified

Unidentified

Unidentified

Unidentified

Unidentified

Unidentified

Unidentified

Unidentified

Unidentified

Unidentified

Unidentified

Unidentified

Unidentified

Japanese flounder(C23419)

Japanese flounder(C23419)

Japanese flounder(AU050130)

Japanese flounder(AU050348)

Japanese flounder(AU050271)

Japanese flounder(C23293)

Japanese flounder(C23291)

Japanese flounder(C821617)

Japanese flounder(C23127)

Japanese flounder(C23374)

Japanese flounder(C23374)

Japanese flounder(C23353)

Atlanic Salmon(x70074)

Sand bass(L21703)

Zebrafish(AI049183)

Mouse(AI049183)

Mouse(MM10434)

Mouse(W77104)

Mouse(AI049181)

Rat(AI009181)

Human(AC006254)

Human(AC006531)

Human(AF003627)

Human(AI806883)

Human(AI418527)

Human(hszz16562)

Human(AI049828)

Human(AI806883)

Human(AI683930)

Tilapia nilotica(AI001527)

Mould(DDU73686)

72

62

73

94

96

75

74

95

83

86

95

81

93

68

64

62

63

64

55

65

63

61

59

59

58

62

60

59

57

77

63

537

315

512

429

280

310

310

247

329

285

179

249

320

371

198

256

654

448

449

350

302

372

451

405

604

569

336

388

316

418

291

565

493

545

513

732

342

511

520

341

326

394

446

266

225

351

379

182

299

266

 

Table 2. The sequence of BE638418 can be used as RSM analysis with HaeIII and TaqI restriction sites.

BE638418: 1-604bp

GGGGATTGGACAGGAACAACTAGAWCTTGAGTGAAGGTGCAGTAATGAAAAGTAGATTGTTTAAC

TTCATGTTCAACCATGAAAATTGTCATGGAAATTATTGAATCTAACTGTCCTCTTATAAAATATA

ACAGACCCTTCTGTCCTGACATAGCCATGCTCAAAGTTCATTTGGCTGACCTGAAAAACATCATT
                
Primer 1 wpe1.jpg (878 bytes)
TTATAAATTCCACGATGAGGATTCTGCCCCGTTTGGCCAAGTGCTTGCTTAGTAACTCTGTTTGT
                                 
Hae III
TTATCTATTCTCTGTAAATTGTTTCTCTACCAATAATTAATTTACCTTTGATATCATTGAATTGA

TCACTCAGTCTGATGGTTTATTTCCTCACCTGGGAATTAAATACAAATTCCCACCACATAAATTA

TGCTTTCATGTGCGTTATATGAACCTTGACCCGTCTGAAAGTTAATAGTCACATGAAATTATTGC

AACTGAAACGTTGTTGCGGTTCAAAGGTTTTATGACACCTCAGTTTTTTCATTATACTCATATAT
         wpe2.jpg (982 bytes)
Primer 2
ACATCGACATTTTTCTCAAGGTACTGAAGCAATAGAACAAATAAACAGATTGTGATTTAAATATA
  
Taq I
AAATTTGATGAAAAAAACG

Acknowledgments:

The work described here was supported in part by a Natural Environmental Research Council ROPA award.

References:

Adams, M.D., Kelley, J.M., Gocayne, J.D., Dubnick, M., Polymeropoulos, M.H., Xiao, H., Merril, C.R., Wu, A., Olde, B., Moreno, R.F., Kerlavage, A.R. and Mccombie, W.R. (1991). Complementary DNA sequencing: expressed sequence tags and human genome project. Science 252, 1651-1656.

Boguski, M.K. (1996). The turning point in genome research. Trends Biochem. Sci. 20, 295-296.

Boguski, M.S., Lowe, T.M. and Tolstoshev, C.M. (1993). DbEST- database for expressed sequence tags. Nature Genet. 4, 332-333.

Ikuo, H. and Takashi, A. (1997). Expressed sequence tags of medaka (Oryzias latipes) liver mRNA. Molecular Marine Biology and Biotechnology 6, 345-350.

Powers, D.A. (1989). Fish as model systems. Science 246, 352-358.

Sadao, I., Bo-Hye, N., Ikuo, H. and Takashi, A. (1997). A survey of expressed genes in Japanese flounder (Paralichthys olivaceus) liver and spleen. Molecular Marine Biology and Biotechnology 6, 376-380.

Sueiro, R.A., Jenkins, G.J.S., Lyons, B.P., Harvey, J.S. and Parry, J.M. (2000). Genotypic mutation analysis in the p53 gene of Benzo[a]pyrene treated European flounder (Platichthys Flesus)

Tilghman, S.M. (1996). Lessons learned, promises kept: a biologist’s eye view of the genome project. Genome Res. 6, 773-783.

 

Appendix 1. EST Sequence Data of European Flounder (Platichthys flesus) Liver RNA

BE638411: 1-654bp

CGGGGGGGGAACTGACATGAAGATGACCTCCTACGAGATGTATAAAGACTATGGCATGGTGGCAG
TGAGCGGGCCGACCTGGGACCAGGTGCCACCCTTCCAGTGGAGCACTTCCCCTTACAAAGRNTTG
ATGCACATGGGTCACCCTGATACTTGGGCATTCAAGCCTATAAAAGTTAGCTGGACTTCCTAATA
GTTATTATGTTGTTATACTATGTGTTCAAGTAGCATGGACAAAACTGTCAGCTGTGCTGTTTTAA
GTTTTGAAAAAGGGAAACAATACTTTGGTTTTATGTTTTTTTCTGAACAGAGGACAAGTCCTGTT
TAATTTGGAGTATTGAACTCTTTGCAACATAACCACAATTCTCACAATCTTACTAAAATGGTGTA
TTATATCAGATTTTGTGTTTTTAAGATGTTGATTTCTAATGCGAAATGTGTGAAAATGAAACAAC
TGCCTATCTGCTGGTTTAGAAATGTATTTGATAGGTGGAAGCACAACATGCTTTGGAGTATCAAT
ACTGATGTTGACGCACATGCAGACTTTCTGTCTCACCAACAGCAATTGAGTTAAATGATTTTGAG
TAATTCTGTTGTGATGCTTTATTTTAATGATCTATTATGAAAACTATTTTCTAAATAAACAGTGC
CCTG

BE638412: 1-291bp

GGGGGGCAAAAACTTACTCAAGTAAATCATGTGATCTTAAAGAAGATGAAATATATTTATCACAA
TTATTCATTTCCTTTGAAGCTGTGCACTTAGTATCTCAGAATTTATTTCTATGATCACTTCTATG
GATTCATGTTTTTATTTTAATGTTTTATTTGTTTTAAATAAACTTGACAGGATGAATTGTTGATG
TCGTTCCAATCGAACCGGTGAGTTTGTGCCAACGACCATAAGCACATGTAAAATGGTCCAGATGA
TTTAATAAAAATTAGGTTCAACTTGTGCAAT

BE638413: 1-565bp

GGGGGGGTTCACTTTTTACAGAATACCTATTATAGAATGGAAATATTTATATACACAAATGAATA
TGTTAACAAAACAATGCAACATTTTGAGCTTTTGAACACCGAGAAATGACAAATACTTGGTGCTT
GTAGCCAAAGATGGTTTTATATTGTAACACGCGGCTCTCAAGCTTCAGAAAAGTCCAGTGTAAAT
CATCGCTTCTCTCGTTTTATTTATGTATCCTTCTATGATTTTTGTTGTGTTTGTTTAAGGATTTC
TGATTCCCGATCGAGGTATTTTTTAACGGACAAGTTTTGATCAACAGCAGGAGAAATATTTAGTG
AACGCATCAACCTCGGTCCCCGCTTTTCCATGTGTATTTTCCGTGGCTGCTGTGGTGTAAGCTAC
ATGAAGGGTTACTTTTGTCATGTTAAGTGATTTCTTCACTGTAGGTGATCATGCCAAAATAACAA
CTGACTACCTACTGCTTTGAAATGCCTTTAACTTTGGAACAGGTCCCACAGTTTAAATAACAGAC
ACTACATCAAATATGCATTTTTCCAGTAATAAAATCTCTGTGCTATTTT

BE638414: 1-405bp

GGGGGACAGAAGACTGAGACTAGAGGTAGGTCCAAGACTCCAGAAATTCGTTGCTTGTCTGGATT
CGAGTTGGAAAAATGTCACAAAATACTAACTCCGGAGTTGGGCCCAACAGTAACCAGGGCACCAT
GAGTGGCAACACCATTAACCCGGTAAACAGTGGAACCATTGGATCAGGGAATACCATAAACACTG
GACAGCAAGGCCACGTGGGAATTGGAAACGTGACAGATATTAATGTCGGAACCAACACAGGACTC
ATTGGTTCAGGATGCAATGCGATCAACAAATGAGAAATCTGCCCTCCGACAGAGTAACTCAAATG
TTGTTCACAAAGTATTAAAGATGGAGGTCATCATTGATTTGAGAAGTATTGATGATAATAAAAAC
AACATATAATATCTG

BE638415: 1-493bp

GGGTGCAAGCAAAGAATAGTGTAATTAATTAAACAAGGGTTGAAAATTAGACACACTCATCTTCA
GACAGACACATACATTGATATAGTTGGTCTTTTTGATTTCTTTTATTAGAAAATTGTGGTAAAAG
TAGTGATTTCTCCTTTTTTTACAATAATGGCGTATTTCTACTGTTCCTTTTTAATGTATCAAAAC
AGAAATGTTGATTCTGGATGTCAGTTAGAAACGTCATTGTGCTATGATGACACTGCATGGTTTGA
CAGATTGCAAGCGGCATATATGTAGCAGAACTTTGTTGATCATGTTTTAATTTTCAGCCATGTCG
TTATGTCCAGGTTAATCTTTTGACTTTTGGTTCTTCTCTCAGGTTGATATGGTAACCTTTTTTTT
TCTACTGTGTGTTTGATTTATGTTTTCAGTCATTTTTAAAGGCAAAAAAATTTGTATCCTGGAAT
TCACTTACAAACATAATAAACATACTTGTGGTTAAATG

BE638416: 1-545bp

GGGAGGGACAGGAACTCAATGTGACCAGAGGCTGGCAGAGAGACTTCAGGAGGAATGTGAAGGAC
GGAGAAAAGGTTCCCTGCTGGTTCATTCACAGTAACGGAACAGGCCTCATCGACGGAGATGCAGC
AGATTACATTGTGTCAGGACTTTTCAAAACCGCTTAAACGCAGGTTACATATCAGTGTCAAACAC
AGAAACCATCACAGTGATAAAAAAAGTTATTAAAAAAGTACCTGCACAGTCATATACTCAAAGAC
AAACAGGTGTTCTGACTTTGATCTTCTAAAAATATATGAATGGAAAGTAAAATAATCCCAAAACA
GTGACAAGAACTGGGAGACATGCTCATTTGTCGTGGAAGACATGGAATACACTGTTCTTGAAGAT
GGACTAAAGCAAAAATGTCTATTAGTTAAACTTCTGTTTTTAAGTCTTGGGATCCAAACAGTTTC
TATCCAGGGAAACCTTGGTGAAAAGGTTTATTACAGTTCATGTAAAGTCTACTAAAAGCATGGCA
CCTAATAAATTTGTATTTCTATGGC

BE638417: 1-513bp

GGGGGAGAAAGGATTCTATGTCAAGCTGCCGACCMATGAGAACGGACACCGGCATCACAGTGACT
TAGTTCACAGCAGAGGCGGCAGTCTGCAACAAACCAAACGCCTCAGGATATAAAGCCTTGCATAT
TTGCAGAACTTGTTAAGCAACTGATTACAGCTGTCATAAATTCCGGAGGTGAAAGGTTCTTTAGC
CTTTGAGCAAAGTATTAATATGTTAATAATGATGTTCTGAATGTCTTTGAGATTGCAGTGTCCTC
AGGTATATTTTAATTGTACTAGGAATCAAGCTGCTTATTCAGCACAGCACGTCAAATATAGTTTA
ACTGTGGTACAACGACTTTATTGTGTCATTTATCATGCTACATGAAATGTATTTTGCATAATTTT
TTTAATTTTTGGCAACAATTATTTGACCGTGAAGTGAATCATGATTTTAAAAATGTCCTTTGTGT
GTAAAACATGCTTTTTTTTGTCAGTGTGGCTTTTGAATTAAAACAAATGTTATCTCAT

 

BE638418: 1-604bp

GGGGATTGGACAGGAACAACTAGAWCTTGAGTGAAGGTGCAGTAATGAAAAGTAGATTGTTTAAC
TTCATGTTCAACCATGAAAATTGTCATGGAAATTATTGAATCTAACTGTCCTCTTATAAAATATA
ACAGACCCTTCTGTCCTGACATAGCCATGCTCAAAGTTCATTTGGCTGACCTGAAAAACATCATT
TTATAAATTCCACGATGAGGATTCTGCCCCGTTTGGCCAAGTGCTTGCTTAGTAACTCTGTTTGT
TTATCTATTCTCTGTAAATTGTTTCTCTACCAATAATTAATTTACCTTTGATATCATTGAATTGA
TCACTCAGTCTGATGGTTTATTTCCTCACCTGGGAATTAAATACAAATTCCCACCACATAAATTA
TGCTTTCATGTGCGTTATATGAACCTTGACCCGTCTGAAAGTTAATAGTCACATGAAATTATTGC
AACTGAAACGTTGTTGCGGTTCAAAGGTTTTATGACACCTCAGTTTTTTCATTATACTCATATAT
ACATCGACATTTTTCTCAAGGTACTGAAGCAATAGAACAAATAAACAGATTGTGATTTAAATATA
AAATTTGATGAAAAAAACG

BE638419: 1-350bp

GGGAATGAAAAGTGCACTTATATTTTGTTTGCCTTTTTGCATATTATAGATTTTGAGTATTGTAG
TGTGAACGTTTAACTTGGATTATTTCTATTAACAGTAGACTGTCAGTATTTGAGGCTAATACTAG
GACTGAGTGACAGTTTCCCCTGAGGTACTTTGAACCATACCAGAGTTCTTATGAGACACTTGTAT
GTCTTGTTATGTTGATCTTATTGACTTGCTTCTGTTGTGTTTGCTATGTACACTGAAGATACGGC
TTGTCAAAATACTTTCCCTTCAAAAAATCCGGTGTATCAGACTACATGCAATAAATATCGATGCA
AATACAAGGCAACAGCTTAAAACAC

BE638420: 1-537bp

GGGGTACTGTATAACATGTTAATATGTGTATTAGACACCTATTTTATAAACTATTAAGATTTCTA
TGATTTATTTGATGATATTGACTTCATGTTGATTTTCAAGCTTGACTCTTGAATTTTCCTCTAGT
TGGTTTGACTCCAGATGATTTGAACATTTGGGTTAAGAATCTGCATATTGGTTTGTAGTCTCTTA
GAGAGTTGTTTTCCCCGTTATATGCTCATTAGATGAGAAACACTTGTATTCCTTAGTGATTTTCA
CTTAAAAATGAGAAGAGTAAAGGGACATTCCTGTAATTTGAACGTGTTGTTAAATACTCAGTAAA
GATTGTGCAATATAAGCTTGTTGATGCAAATGTGAACTTACGGACTGACATAAGAGGTGAATAAA
CCTCTAATAAACATTGATAAATGTACAGGAAAGCATTTCAATGTGTTGGATATATATGTTTATTA
TGACTGTGGTACTGTACTTCTCAACAGGTGCTGTAGAGTATAAAACTAAATAAAAACAATAAAAG
TTAACAATGT

BE638421: 1-732bp

GGATGCACGTAAACAAATGTACATCCGGCCACACNCCACGTACGTGTCCTCGTGACTGACCGGCT
GTAGGTCGACCGGAACTGGACCCGAGTCAGAATTCCCAAGGGGAAACCATCTGCACCGACCGGTC
GTCTCCATACATTCAGCAGGGACTTCACACGTTGATAACCAGCATGGAGGAGGTGGGTTCACACT
GGGCTCAGGTTGTTTCTACATGAATCTGTCTTTGGATTGGACTGTGATGAAGTGTGATGAAGAAC
GTTCTTGTGCAAACATGACTGTGTTCAGAAATGTTTTTATTTTCCCATGCACACAGGGAAAACCT
GCAAGTGCAACAGGATACAGTACAATTGTCTTCTGGGTCATTGGTTTTTTAAAAGCAAATCCAAA
TTACACATATACAATCATGATTTTCCCTTTTTATCACATGTGCAACTTAAGTGTTCCGTGAAGTG
CCGGTCTCAGTTCCTTAAGAAAACAAAGGAGATCATGTTGTCGTCACACAGGTGGGATCTCAACA
GATCTCAAGGGAAAAAGAAAATCCCCCTGAAGACGTTCAGAATATCAGCAATCTGTGAAGTTACA
GTTATTACCTCCACCTATGTTTTCATTGATGTTTGTTAATTGAAGTTTTTTTTTCACTTTCTTTT
ACATTTTTGTGAAATAATCATTTCGGAGGGAAATATTATGAACACTTTCTGTAATATTCAAACTA
TTTTTTCTGTCACACAG

BE638422: 1-569bp

GGGGGGGTTCACTTTTTACAGAATACCTATTATRgAATGGAAATATTTATATACACAAATGAATA
TGTTAACAAAACAATGCAACATTTTGAGCTTTTGAACACCGAGAAATGACAAATACTTGGTGCTT
GTAGCCAAAGATGGTTTTATATTGTAACACGCGGCTCTCAAGCTTCAGAAAAGTCCAGTGTAAAT
CATCGCTTCTCTCGTTTTATTTATGTATCCTTCTATGATTTTTGTTGTGTTTGTTTAAGGATTTC
TGATTCCCGATCGAGGTATTTTTTAACGGACAAGTTTTGATCAACAGCAGGAGAAATATTTAGTG
AACGCATCAACCTCGGTCCCCGCTTTTCCATGTGTATTTTCCGTGGCTGCTGTGGTGTAAGCTAC
ATGAAGGGTTACTTTTGTCATGTTAAGTGATTTCTTCACTGTAGGTGATCATGCCAAAATAACAA
CTGACTACCTACTGCTTTGAAATGCCTTTAACTTTGGAACAGGTCCCACAGTTTAAATAACAGAC
ACTACATCAAATATGCATTTTTCCAGTAATAAAATCTCTGTGCTATTTT

BE638423: 1-342bp

GGGGTGACCAATAAAAAGACTGAAATTGAAATTCNCTTACCCTTCCGTTGGAAGTCTTTCAGCAA
CTGGCCAATGTGATCAAGTCAGTGAATCATGGATTTCTTCATCAAGGCNACGACATTTATGTCCT
GATAAAAAAAATGACTTTTTGTACATTGCCAATAAATATTAGTTTAAAGGAATTTTAGTTCTTAT
GAAATATACTCAAGTTATTCTGAAGTGATATTGCTTTATACTTGACAATTTATACCGTTATGCCC
AATTAATGTTTAGCATGTTTTGAAAGATTGTTTGATGATGGCGGTCAGTTAAACAATAAATAAAA
CAAATGTTTGCATTTC

BE638424: 1-511bp

GGGAGCTGATCAAACTGGAGGCGATGAAGACTTATCTCTTTTTTTTGTTTATATAACAAAGCATG
AGGACGGTGTCAGAGAGCAAGTTATTTCTGAACACTCACCAGACATGACTCGGGTGGAAACCTCT
GCGTAAACAATCAACGTCAAGATCTACAATAGGACAAACCATTGAATCTGTACATAATGTCAATA
ATGTAGCTGATATAAATGAGCTTTGTATAGTATTCTATATGGTGTTGACTGATGCTGTGTATTTA
TGCAATGATCAAATGATCTCTGTATATCTTAATTTGATCATTATTATATTACCCATGACTTGTAT
AACCCTTATGTATTTAAGATACACATTTTTGTACAGTGCATCTTGTTGTCGGTTTTACAGTGCGA
GTGTCTTAATCGCTCAGTTATCATCCAACATGTATCAACGTATGAAGTGATTTATTTTGTTCTAC
CGATGCGCGATGGGGACATTTCAATAAAGAGAAACATTATTTAAAATGACATTCT

BE638425: 1-512bp

GGGGATGATGTGTTAAAGGTCCAGWGTGTAAGWNTTACCTTTTTAGAATAGGCCTTTTATATTTA
ACCACTTTATTTTAAGAAGGAAGTGGAGGGTGAGGTGAGGGGTATCCACCTGCAACATGCAGCTT
AACCACTAGATGTCACTAAATTCTACACACTGAACCTTTAAATACTGGAATCATGTTATCTTGTA
AATTCAGAGATATATATTTTAAATCTGAGGTTTTTATATATATGCATATATATTTATGTAAAACC
TTAAATGATGTCATCTTTAATCATGTTTATATTTTATGATTCTGCTGTGTGGGCATCGTTGGGTT
GCTTCTATCTAATTTAATTTGTACAAATCTATATCTATTCAATCTATTGAGATTTAAAAGAACAT
TTGTATATTTTGTTTAATTATCTCAACCTTCCCTGGTAACGTAATGATTTTTTGTTTTGAATGAC
TTTTACATGCTTCTGTAAAATGTAATATTTGTCTGTTCAATAAACTGGTAAAACTGG

BE638426: 1-520bp

GGGAGAGCTAAACAGATTATTTTANTGAAAGCTTNTTTGGAATCTATCAAAAATAATTCTTGGAA
GTCATGGTACTTACTGAAACTCCAAACCTGTGAAAAAAAAGGTCATCTACTTGGACGACTAATGT
TAAGTTAACTAAGTTATTTTATGTTTTGTTATTTTATGACAGTGTTTGTTTCCTTTTATCAGTGG
TGAATGTCCCATCAAACACAAACACACACACACATGGGTTGACTCGTTAAGTTATCAAAGGGAAG
TTATTCAGATGCTGTGCAGGTAATATTGCTGTTCCTTGCAGTGTAATGACCACACACCATTTTGA
GATTTCTGTTTCACAAATACTGTTCTGGTTTTGAATTACAGAGATGCTATCATATTTTTCATTAA
TATATATATATATACATATATATACACAGATTTTCTCTATTTTTTTCTTAGAAAAAGATGGTCAC
TGTTTCCAATATAATAAGAACTTGGATGCTTATTTGTCCAGTAGTTAAATAAACTGCGTCAAG

BE638427: 1-341bp

GGGGCTGTACATGAATATTTAAAGCGAACAAAGCNTTCAGTTTAACATCTTAGTCCGATCCTCGA
CATTCTTCACATGTTGTTTTTTGTGTTTGTTTTATATAGCGACTTCGGTGTAGTGTGAGACCACC
ATCGTAATGGAAACCAGTGGAACTTGTTTTACTGGTCCAAGTGACAAAACCATGTTTACTAAAAA
CACTGAATGATCCTGAAGCACAAAGGTTGTTAATAATCCTAAATGCTTGTGTTCTATAAGTGTAG
CAGCTTGGTTGTGTCTCCAATCTATGTGTTGTGTTGTGTGTGTGTCTTGATCCAGTTTAGAAATA
AAACATTCATATCAC

BE638428: 1-329bp

CGGGGAACGAGGAGAAACCGGATGTAACAAGGGCAGAGAAGAAATAGGCTGCCTGAGGAAATACA
TAGAAATCCATTCCGTGTTTCAAATACAAGTTTGTCTTTAAATAATTACAGCATGAATTTATGAT
TAGGTGAGTTATTGTTGATGTTAAAGCATTTTGTTCACAACACCCCTCTAATGTCCCCTGAGGTC
CTGTGTTGACAAATCCTCCTCAGTAATAAGTAATTTGCCGCTGGACAAAAGATGGCAAGAGATTT
TTTTGTGATGTAATTGAGTATTAAACATCCTCATGTGTAGGTACTTGAATAAACGTGTGATTAAA
AGAG

BE638429: 1-310bp

CGGGGGAGCAAGAAAAAAATTGTTGAATATCAAATATATAATTTTCTTGACATTCAGAATAAAAG
AGGAAAGAAGATGTACGAGGGTCAAAACATATTTGAGGACAAAAATCAAAGGTGGTTTCATCGAT
CTGTTTGACGTGATTGTGAAATCCCACAATAATTTACGACCAGTGTCTGTGTTTCTTCACTTGTG
TATTTGTCGACCCACTGTGTAAACATGTGTAACCTGTTTGTTAGTCCATGGAAAAACCTGATGTT
CTCCGTGCTGCTGAACTCTGCTCGATCAATAAAGATTCAATGTTCACTCC

BE638430: 1-336bp

CGGGGGGGAGGTGTACACGTAATAACAGACACAAAGGAGTTGAGTTAAAGTTTGATTTCTTCTGT
ATTTCATTTGTAAACAGAATATGGGTTAAAAAAAGGAGAAACACATTTGATGATATTTTGATGCT
TATGAGGGATATTCATTCATTACAAAATATTTTTGGTGTTTTTGTGATTGAACCGTATTCTATAA
TATAAACCATTTACAATGCATTATGTATGCACAGGACATTTAGTGTGAAATATTTGATGACGATA
ATGCATTTACAGCAGTACTCAGAAATACACTTTAATGTTCGCATTTCATGTGGCACTTAATAAAA
TCGCACAACCC

BE638431: 1-302bp

CGGGGATGATATGATTCCTTCTTTAGCTCATCTGCTAAATCTGGTCAAAATTATTCAGTAAGTGT
TGTTGTGGAAATATTCTGATGTCACGCCGCTATAGAAAAACTGTTTAGTTCAGATCTGCGGGGCA
TTTCTTATATTGGCAAAAAAAATTACAAACAAAATGAGAAGCCTTTGTTCTGCAAAATTTGTCTA
TTTGGAGAGCATTCAAATTCTGAAAACCTGGATGTGTTTGGAAATTTGTGAATTTGCATTGTTTT
TCCATCACTGTATACAATTTTGCTTCAATAAACAGTTGTCAT

BE638432: 1-388bp

CGGGGGACAGAAGACTGAGACTAGAGAAATTCGTTGCTTGTCTGGATTCGAGTTGGAAAAATGTC
ACAAAATACTAACTCCGGAGTTGGGCCCAACAGTAACCAGGGCACCATGAGTGGCAACACCATTA
ACCCGGTAAACAGTGGAACCATTGGATCAGGGAATACCATAAACACTGGACAGCAAGGCCACGTG
GGAATTGGAAACGTGACAGATATTAATGTCGGAACCAACACAGGACTCATTGGTTCAGGATGCAA
TGCGATCAACAAATGAGAAATCTGCCCTCCGACAGAGTAACTCAAATGTTGTTCACAAAGTATTA
AAGATGGAGGTCATCATTGATTTGAGAAGTATTGATGATAATAAAAACAACATATAATATCTG

BE638433: 1-326bp

CGGGGAGATTGTGTGGTGCTATTGTTCTGATAATGAAAGATTCAAAACATAATTTATCACTTTTA
TTCAGTGCTGAAGAAAAAATTCTAATTTCTTTAGTTTGACTAAATTGGCATGAGCAGGATCAAAC
TGAGCTGAAGATACAAAGATCAGATGTTCGTGTTCGGGTTAGAAACTCGACAAACCAGTTTGAAT
ACAACAAAGATTTAAGATGGAAAATATTGAGAATAAAACTTTCTAGGTTCTGACACTTTGACTGA
ATCTGCTGTTTGTAAATATCTTTTTTTCAAGCTGAAGTGAAACATTTGAATAAAACTTTATATCC

BE638434: 1-394bp

CGGGGAAACATATTCCATGTGTTTGGCGGGATTGGAGCGTGGCTGTTCGTTGCTTCAATCGCACA
ATCACTCATACCCGCTGCTGTCACAGAGATGACCATTATAGGCGTTATTGCACCTAAGGTACAGC
GAGGGAGCTCCTCCTTCCTGTTGGATGACTCATCAACGACTGACAACCAAAGCCGAGCAGGAAAC
TGATGAAATCCCTGCAGCAGAAAACAACAGTGGATTCTTTTTTAACCAGATGTATTTCAAAGATC
CTCACAGTGTTGGAGCTTGGTGCTGTTTGACAGCCGGTATCTTCATAACTGGAGCACATGATCAA
TACTACTTATACACTGTGCTGGTGTATGGCTACAGTAGTTTGAATAAAATGTCCACTATACATTC
CAAC

BE638435: 1-446bp

CGAGGACTCAAATAAATCCAATAACCCCCTTAAAAAACATTTTATCAACCAAAGATGTTAAAAAA
AAATTGTTTTGCTCTATCTTGTAATTTTTGTGTGACAGATTTTTCTTGCAGGGTCTCAAATAATT
GAGTTTACCCAAATAATGAAGGGGAACGTGATGGATGAATAGTTTATTGTGTTTAAAAAGTGTTT
TACTTTGAAACTTAATTAGAGTTTTTTTGATTAGAAGTAGTCAAATATTATCACTGCCTTTGACT
TTGCTGTGAGAGATAGTTTGTGATTAACAGCATCAGAGAGGTAGAATGTTTGAGTAGGTTCATGT
AGAAATAAAATCATTTCAGAACATTCTTACTGTTATATAATTATTTTAAGACGTTAATGTTAACA
TTTTATACATTTCATTGCTGATACAATTATTGGAATTCTTTTGCATGTCATTAAAGTTT

BE638436: 1-266bp

CGGGGGCCGAGGACATCAAGGACCGTTTGGAGAGCACAGCTGAAGAGATGAAGAGCACCCTGGAA
GAGAAGATGGAGGAGGTGCGCACCTGGTTCAAGCCCTATGTCTCCATGTTCACAGCATAACCTGT
CATCAGAGAGTCCGGACTGACTGTTGATGCACATGTAAAGAGGGATTAATAACTGAAGTTGATAA
GCTAGGAAGACGTTTTTGTGTCATGACTGATGTCGTCCAATAAAAACCAGCTGCTTAAAACCTGA
GTAAAC

BE638437: 1-256bp

CGGGGGAGCAGAAGTTGCTCTTGTGGGTGAACAGATGGACGGAGAGGGGGGGGTCAAACTTTCCC
GATGGGCCCTTAGTTTTCAGCACTTATCTATTCCTTCATTCTGAGAAGATGTGAGTGAAGCATCT
TCCTCTCAAAGTCAAGGATTCCCCCTCTTCTTAATAAATCTGCTTTTCTACATCACATCTTCTCC
GTGTAGTGTCTTTGTATTTTCATCAAACTGTGAAAACCTGATTAAATTTGAATGTGACACT

BE638438: 1-320bp

CGGGCACCTCCAACATGTTCTGTGCTGGATTCCTCGAGGGAGGCAAGGACTCCTACCAGGGAGAC
TCCGGTGGCCCCGTGGTGTGCAACGGTGTGCTGCAGGGTGTGGTGTCCTGGGGCTACGGCTGTGC
CCAGAGGAACAAGCCTGGAGTCTACGCCAAGGTCTGCAACTACAGCTCCTGGATCCGCAGCACCA
TGTCCTCCAACTAAACAAAGTCCTGCATTACAATGGATGAAAACAGTTTATAATAATAACATGTG
ACCAATAGAGCCAGAGTCACAGTGTAAACATTCTGAAGTGATGTGTAATAAAAATATACG

BE638439: 1-372bp

CGGGGGAAGATATTTTAACTTGAACTATGCCATTTATTAATTATACTGTCCTCGACCCAAAGGGA
CAACGCTAATTACCTCACTTCCAATCGTTAAATAATGCAGTGTTTGTATTCAGTGAACCGCAGTG
AACCGCCCTGAAAGTCATCTCAGTGTCTTCTGCTGCCGGTTGAACGTTGAGTTGTTGTTAGTTTG
CACAGTGATCGTCTGAACTCTTGCGTAAGACTCAGGGCAATCGCACAAACACACTAATGATCAAC
CTGTTTGCTATTATAGCACTGTGCACAGTGCACAATCTGCAGCAGTCAGTCTGTTTAGAAAGTGA
CCTGAATCATTTGCCATTTTAACTACTCTAATAAAAACCGTTAATAGC

BE638440: 1-285bp

CGAGAACGTACAGCCCATGGTAGAGAACTTCCAGAAGCAGATGGAGGACCTCGTCAAGAGGCTGA
TGGATCAGACCCGTAGCGTCGCCCAGTAAGCAAGCCGTCCTTCCAAAGGAACGTGCAAACGTGCC
ACCACAACATCATCTTCTCCATCAAGGACTGAGCTCATGGGGCGGCTTGCATTCAAGGCTGGCCA
GACAGCGCCACGGCTTAAAATGTGTTTCAGTGCTTGTCAACACTGATATTTAATTTCTTTGTCCA
GAAGCACAATTAAAAACCTTGGAAC

BE638441: 1-225bp

CGGCGTATCACAAAGTGTTCTGTACAGTTGCTGGGTAAATCGACGAACATATCCATCAGACCAAC
TGTGTTGTGTGGTTCCCAGATTCTTTGCTGTAAGTTAAACCAATGAAATGAATGCGAGTGTCACC
TTTAAAATAACCTACATTACTTACCACCATGATTAGTTCATATTGAATATTGGTTTAAGACTTGC
ATTAAAATCTGTACAATAAAAACTTAAAGG

BE638442: 1-351bp

CGGGGGGAAAAAGTCATTGTCATGTAATTAACATGAGAGCTACTTAAATTCAGGATTTGGGTTTT
GAGCCTGTAATTGTGATTCAGGATTTACCCAGACTTTGCAGACTGTGGCGTTTTAGTTTTCACTA
TACGTAAAGATGAGTTTTAAGCTTTTCCTGATGAAAGATTCAACCACCGACATCAATTAATTGCT
AAATTCAGATCAGTAAAAAAGGCAGTAAGAAATTCTCTAGATGGTTGTTTCCCGGTGGGTGTCTC
TACTGAAATGGAATTCTCCAAGAATATACGTTTCCAGATGACATATCTCCCCCAGCTAAAAAAAC
AAAACACTCTTCTGTGCCTTTTTTGTACAAGAACTGGAAAATACAAGAGACTTTTATCTGAAATA
ATCTGTTTTTCTGGTTTGGATTTAAGACTAAATGACTCCTTGTTCACATGTAGAAAGAGAT

BE638443: 1-371bp

CGGGGACAACGGATGAAATTGGGGGATGAGGTTAGATATGGATGCAAATCAGGCTACTGGAAGAC
GGGTGGTTCCACCTGGGCCAGGTGCACCAGGGAGGGCTGGAAACCAGATCCATTGTGTCAAGCTG
CTCCAGACCAGTGATCCTGATTTTCAACGTCGTTCAACGAAGTGAAAAGAATAATTCATTAAAAT
GTGTTGTTTGTTCTGATTTAGGAGAAAGAAAACCATGTTTTGTTTTTCATACCAACGTCATGAGA
TCCTGCTACATGCAACCACTGGAGTGTCCATGTGTCCCACTGGGAACATGCGATAACGTGATCTG
ATGTTGTGAAGCTTGTGTTGAATAAAAGAGGTGAATTATAAGATCTAAG

BE638444: 1-448bp

CGGGGGGGGAACTGACATGAAGATGACCTCCTACGAGATGTATAAAGACTATGGCATGGTGGCAG
TGAGCGGGCCGACCTGGGACCAGGTGCCACCCTTCCAGTGGAGCACTTCCCCTTACAAAGACTTG
ATGCACATGGGTCACCCTGATACTTGGGCATTCAAGCCTATAAAAGTTAGCTGGACTTCCTAATA
GTTATTATGTTGTTATACTATGTGTTCAAGTAGCATGGACAAAACTGTCAGCTGTGCTGTTTTAA
GTTTTGAAAAAGGGAAACAATACTTTGGTTTTATGTTTTTTTCTGAACAGAGGACAAGTCCTGTT
TAATTTGGAGTATTGAACTCTTTGCAACATAACCACAATTCTCACAATCTTACTAAAATGGTGTA
TTATATCAGATTTTGTGTTTTTAAGATGTTGATTTCTAATGCGAAATGTGTGAAAATGAAA

BE638445: 1-418bp

CGGGGGGCAGTGAAGGAAATGATGGGGATTGGTAGAAAGAAGGCAGGGATTTGTTGGAATACAAA
GGTTACATTCCATTTATTTTCAGTTGCTTAACTTTATACTCTTTATTTTGTTCTGTTTTTGGGTG
AACTGCTCTTGTATTTTTGTTTTCACTTTTGAGGTATAGAAAATGTTGAACTAAAGAGCACACAA
CCTTGTTGCTGTTTTGTATAATATGGCAGTAAGAAAATCCCACATGTTTATCTTGTTTCTACCTT
TTCAAATTTTTCTTTCAGAACTTGCCTAAACTGCATGTTGATACGTAGTTTCTCGAGATGCAAGA
AGGGTTTTTGTCTTAGGGATTACCCTAGAGAATTTTTATTGGGAGAAATGTGTAATTTCATGTAG
GTGAAATAAACAAAACAAACTTCTGTTG

BE638446: 1-451bp

CGGGGAATCTGATGTCAGATCTGTTTTGATATTGTCGTCACCATGGTAGCAGAGAATCTGATTTT
CCATTCGTGCTGTAATTTTATATGTCAACCTCTGAAATGATAAAACCTAATATTTATATTTTATA
TGAGCGACGTATATTAACCTCTACTGTTTTTTGTGTATTTATATAATTTGTGTAGCGCTTTGTGA
TGTAACCTCTTTGAAATCCACTGCAGGACATCAGCTCGATTCTTCTTTTACCTTTTGATACTTTT
CTTCACTTTCTGATCGATAATTAGAGGAATTATTTTATATAAATATAAATAAATGTACAATATTC
CTTTTTATAAACATTACATATCTATAATCTTTTCTATTCATTGCTTGTGCTTGAAAATTAGTCTT
TATCACAACTTTATCTGTATATTATTTGTATGTTAATTGTGTCATATTGAAAGTCATTTAT

BE638447: 1-449bp

CGGGGACTTCAAATTTTTTCTTTCAATTTCAAGCTTTATTTCGGTACATAATCCATTTCAGTTGA
ATTACAGTCTATTGTCACTGTTGTGAATTGTGAGCTCACGAACTCAATGCACAAGCGTTCTTGTT
AATGTGCGTTTACATTTTCATCGGATGTTTTAAACGGGTACATCAACCTGGGAAATGTGACTCCT
GCCATATATGAAGCCTTACAAATATTTCTTATTGAATGAATGTAAAACATTTTTTTAAGACCGAC
TACACCTCGAATCATCATTTAATATATACTAAATCCTCTAAGTGTTACTAAATTAACAATTTAGT
AGCACTAAGATGATTCCTTATAGCATTTTGTAGTATGAAATGTAATTTAAGTATTTATATTTGGG
TTTGACTCTTAAACTCGTTTTTGAGGAGTTTAAGAGTTTAAGTTAAAGTCAAGACATTA

BE638448: 1-379bp

TGGGGACGAAACAGTTTATTTTCTTTTAAACTAAAGCTAATATGATGCCATTAGAGTTTCTGTAG
AGAGATAAACATGAAAAATGGTGAAGGGGCAAAAACTTACTCAAGTAAATCATGTGATCTTAAAG
AAGATGAAATATATTTATCACAATTATTCATTTCCTTTGAAGCTGTGCACTTAGTATCTCAGAAT
TTATTTCTATGATCACTTCTATGGATTCATGTTTTTATTTTAATGTTTTATTTGTTTTAAATAAA
CTTGACAGGATGAATTGTTGATGTCGTTCCAATCGAACCGGTGAGTTTGTGCCAACGACCATAAG
CACATGTAAAATGGTCCAGATGATTTAATAAAAATTAGGTTCAACTTGTGCAAT

BE638449: 1-429bp

CGGGGCTCTTTCCAGCTTCCCGTGCAACATGACTAAGAAAAGGAGGAATAACGGTCGTGCCAAGA
AGGGCCGTGGGCACGTGCAGCCCATCCGCTGCACCAACTGTGCCCGCTGTGTCCCCAAGGACAAA
GCCATCAAGAAGTTTGTCATCAGGAACATAGTGGAGGCTGCTGCCGTGAGAGACATCTCAGAGGC
CAGTGTCTTTGACTCTTATGTTTTGCCCAAGCTCTATGTGAAGCTTCACTACTGTGTCAGCTGTG
CCATCCACAGTAAGGTGGTGAGGAACCGCTCCTGTGAGGCCAGGAAAGACCGAACCCCTCCACCC
AGATTCAGGCCCGCTGCTGGTGCACCAAGAGCTCCTCCAAAGCCCATGTAAAGCAGATTGTGAAG
ATGCTGTAACAGCCTAAAGAATAAACAAATCTTTACATA

BE638450: 1-316bp

CGGGGGCTGAAGCACGAAGATCTTTTCAGACCAATATTTGACCAAAAAGTAGAAAAATGTTTATCA
TAGAGGTTTTGAATGCTTTAAAATGTCCTTAAGGGGTCAAAACGTTCATTAACTGCTCAGCGTCTT
TCCATTGGGCTGAGATTTACTATGCATCATTCATCTGGCCGCTTATGTAATGTTTTAGAATTAAAT
TGTTTGATTCCGGGTGACATGTGAAATGTTGGACCAATAAATGCAACTGATATGATATTTGTCAAA
GGTGTATGCCGAGGTTGTTATTACAGTGCAATGAATAAATATTTTCAAACAC

BE638451: 1-315bp

CGGGAGATGAGAAACACTTGTATTCCTTAGTGATTTTCACTTAAAATATGAGAAGAGTAAAGGGAC
ATTCCTGTAATTTGAACGTGTTGTTAAATACTCAGAGTAAAGATTGTGCAATATAAGCTTGTTTAT
GCAAATGTGAACTTACGGACTGTGACATAAGAGGTGAATAAACCTCTAATAAACATTGATAAATGT
ACAGGAAAGTCATTTCAATGTGTTGGATATATATGTTTATTATGACTGTGGTACTGTACTTCTCAA
CAGGTGCTGTAGAGTATAAAACTAAATAAAAACAATAAAAGTTGACAATGC

BE638452: 1-198bp

CGGGGGGAGCCAGAACCCACAGTGCTATAACGGGTACGTCAGCTTGTCTTGGTCTGGGAACACTGG
CCTTCTTCACAAAAGTCAGCAAGGTGGAGGGATGGAGGCTTGTTGGACCACCCAAACTGTGAGGAT
CAAGATCACTGTAAAATAACGTATATGTTGTAAAAAGAGTTCATGAAATAAAGTTATTATGAAAAC

BE638453: 1-182bp

CGGGGTAGACGTGAAATTAGTCCAACTTTTTGTTTAGTATCTTCTATCCTATCCTATTTTTATAGA
TTTCTCTGTCTTGTCTTACCTTCTCTGACTAGTCTTGTGAACAGATTTTATATTATATGTTTCCCA
TGAATGTAATTGTAACTTTTTTAAAGAATAATAAAAACTCCCAAAAAATT

BE638454: 1-179bp

CGGGGGAACATGCAAACGTGCCACCACAACATCATCTTCTCCATCAAGGACTGAGCTCATGGAGCG
GCTTGCATTCAAGACTGGCCTGACAGCGCCACGGCTTAAAATGTGTTTCAGTGCTTGTCAACACTG
ATATTTATCTTCTTTGTCCTGAAGCACAATTAAAAACCTTGGAACAC

BE638455: 1-310bp

CGGGGGAGCAAGATGAAAATTGTTGAATATCAAATATATGATTTTCTTGACATTCAGAATAAAAGA
GGAAAGAAGATNTACGAGGGTCAAAACATATTTGAGGACAAAAATCAAAGGTGGTTTCATCGATCT
GTTTGACGTGATTGTGAAATCCCACAATAATTTACGACCAGTGTTTGTGTTTCTTCACTTGTGTAT
TTGTCGACCCACTGTGTAAACATGTGTAACCTGTTTGTTAGTTCATGGAAAAACCTGATGTTCTCC
GTGCTGCTGAACTCTGCTCGATCAATAAAGATTCAATGTTCACTTC

BE638456: 1-249bp

CGGGGATGCAAAAGCAATACTTTGTACTAGACGACCAGCAAATGTATTAACATTTCCACTTTCCTT
TGCTTTTTCACTGTATGTTARATTGACTGACACCTGACAGTTGTATTGTGTCAAATTACAGAACAA
CCTATGCAGTATTATAGTGCACTTAGTTATGCATAATCATTAAATCAAGCAAACTGCAAATAATGT
GTGTTGAACTACTTTGTTGTTTCCTAAAAACCTAATAAAGAAATGATGATTAAAAC

BE638457: 1-299bp

CGGGGTGAAACAAAAGACGTAATTTTACACTTCTGATATGTACGTAGAAGGAAAGGGTAAGAACTG
TGGCTAAAAATCACCATCAATATTAATTTACAATTAATAAAGTCTGAATATTAAGTATGTTATGTT
TTGATGTATTTCTATCATGCTTGTGTTTAAAGGTTTATGGCTTAATGTCCAAATCAATTTGTTTTC
TCATGTTTATTTACTAGTTTTATAAAAACATGTCCACTAACTGTGAATGTAATCGTTGAATAAATA
CTGAAATACTGAAAAATAAATCAATACTGAAAGAT

BE638458: 1-266bp

CGGGGGCCGAGGACATCAAGGACCGTTTGGAGAGCACAGCTGAAGAGATGAAGAGCACCCTGGAAG
AGAAGATGGAGGAGGTGCGCACCTGGTTCAAGCCCTATGTCTCCATGTTCACAGCATAACCTGTCA
TCAGAGAGTCCGGACTGACTGTTGATGCACATGTAAAGAGGGATTAATAACTGAAGTTGATAAGCT
AGGAAGACGTTTTTGTGTCATGACTGATGTCGTCCAATAAAAACCAGCTGCTTAAAACCTGAGTAA
AC

BE638459: 1-280bp

CGGGGAGACTACCTGCATTACATCCGCAAGTACAACCGATTTGAGAAGAGGCACAAGAACCTCTCT
GTCCATCTGTCACCTTGCTTCAGAGACGTCTCAGTCGGAGACATCGTCACTGTCGGAGAGTGCCGA
CCACTCAGCAAGACCGTGAGATTCAACGTCCTCAAAGTGACCAAGGCTGCTGGAGCCAAGAAGCAG
TTCCAGAAGTTTTAGGCGTGACTATGAACAGGAAAGCTGCTGTTGGCTAACTTGTCTCATTGTCAA
ATAAAGAACCTTGTTT

BE638460: 1-247bp

CCGGGAATtCGGCCATTATGGCCGGGGGTTGATGAAACCGGAGTTGAGGTTAAAGACATTGAACTC
GTCATGTCGCAAGCCAACGTGTCGCGGGCGAAGGCTGTACGGGCCCTGAAAAACAACAATAACGAC
ATTGTCAATGCTATTATGGAATTGACGATGTAAAGGGACTGTGTCAACGAGGAGTTGGAGAAATGT
TGCTGATTTAATCTAAGCTCGTTTATACAATTTATACCCAAGATGGAAATAAAGTTGTGGCTTGAT
AAAAT